The_Yeast_Key

Author: H4N5

Many years ago, the legendary baker Lionel Poilâne entrusted us with his original sourdough recipe. It's been locked away in the Vault ever since.

Only Poilâne knew the passphrase, and now he's gone. The only clue left behind? A strand of synthetic DNA extracted from his prized baker's yeast.

Can you decode the DNA and recover the vault key? The DNA is:

CGAGCTAGCTCCCGTGCGTGCGCCCTAGCTGTATACCGGCATAACGTGATATCGTACCTTCTAAATAACGGCATACATCACGTGATATCCTTCGTCATCAATCCATCTATATCTAGCCTTATAACGCGCCTTATCCATAACTCCCTAGCGCAATAACTCCATCGCGGACCTTCTAAATCAATCCATCCCTAACGGACTAGATCAATCCATATCCTTATACATCCCCTTCGATCTAGATAAATACATCCATCCATCACGTGATCTCCCGATCACTCCATACATCTAGACATGCATATCTTC